ID: 1019431646_1019431653

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1019431646 1019431653
Species Human (GRCh38) Human (GRCh38)
Location 7:1002272-1002294 7:1002290-1002312
Sequence CCTGTGGGTGAGTGGAATCCTGT CCTGTGGGTGGGGAGTCCTGTGG
Strand - +
Off-target summary {0: 3, 1: 37, 2: 34, 3: 14, 4: 134} {0: 37, 1: 26, 2: 18, 3: 51, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!