ID: 1019438250_1019438261

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1019438250 1019438261
Species Human (GRCh38) Human (GRCh38)
Location 7:1032656-1032678 7:1032689-1032711
Sequence CCCTCAGAGGCTGCAGCCACCCG CAGGCACCCTCAGGTGACAGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 2, 3: 23, 4: 205} {0: 1, 1: 4, 2: 3, 3: 24, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!