ID: 1019525431_1019525434

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1019525431 1019525434
Species Human (GRCh38) Human (GRCh38)
Location 7:1478477-1478499 7:1478491-1478513
Sequence CCTCGGCCAGGCGCAGGAGCCCC AGGAGCCCCCCTCGCACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 449} {0: 1, 1: 0, 2: 1, 3: 8, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!