ID: 1019527905_1019527919

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1019527905 1019527919
Species Human (GRCh38) Human (GRCh38)
Location 7:1489035-1489057 7:1489074-1489096
Sequence CCCCAGCCTGCCCAGTCCCCACT GCGCTGCCCAGAAGAGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 98, 4: 967} {0: 1, 1: 0, 2: 5, 3: 18, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!