ID: 1019541918_1019541928

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1019541918 1019541928
Species Human (GRCh38) Human (GRCh38)
Location 7:1555439-1555461 7:1555479-1555501
Sequence CCAGGGGGACGCCGGCTGTCTCC ACTCATCTGCAGAGGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 34, 4: 123} {0: 1, 1: 0, 2: 3, 3: 37, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!