ID: 1019542625_1019542634

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1019542625 1019542634
Species Human (GRCh38) Human (GRCh38)
Location 7:1558411-1558433 7:1558459-1558481
Sequence CCCTCTGGCTGTGTCGGGATCAC ATGGCTGGGGGCCCGTTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 86} {0: 1, 1: 0, 2: 2, 3: 10, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!