ID: 1019577479_1019577494

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1019577479 1019577494
Species Human (GRCh38) Human (GRCh38)
Location 7:1744479-1744501 7:1744510-1744532
Sequence CCCTGAGAGTGCAGGCACCTCCC CCCTCCATCCCTCTGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 221} {0: 1, 1: 1, 2: 4, 3: 33, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!