ID: 1019588273_1019588292

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1019588273 1019588292
Species Human (GRCh38) Human (GRCh38)
Location 7:1816292-1816314 7:1816331-1816353
Sequence CCCTCCCTACACAGCCCCTCCAG CAGTCTGAGGACCTGGACAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 55, 4: 587} {0: 2, 1: 0, 2: 4, 3: 27, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!