ID: 1019594146_1019594157

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1019594146 1019594157
Species Human (GRCh38) Human (GRCh38)
Location 7:1850635-1850657 7:1850661-1850683
Sequence CCGGGGACCCCCAAAGCCATGGT CCAAGTTCGCAGAGGGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 245} {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!