ID: 1019595914_1019595922

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1019595914 1019595922
Species Human (GRCh38) Human (GRCh38)
Location 7:1858328-1858350 7:1858374-1858396
Sequence CCTGGCCCACTCTGGGCATGACA GCCTTGGCTCAGCCTCCACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 37, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!