ID: 1019595914_1019595924

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1019595914 1019595924
Species Human (GRCh38) Human (GRCh38)
Location 7:1858328-1858350 7:1858379-1858401
Sequence CCTGGCCCACTCTGGGCATGACA GGCTCAGCCTCCACCTGGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 74, 4: 1168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!