ID: 1019618946_1019618952

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1019618946 1019618952
Species Human (GRCh38) Human (GRCh38)
Location 7:1980190-1980212 7:1980212-1980234
Sequence CCCCGCTGGGGGACACGCCTGAG GCATGTCCACTTCCTTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!