ID: 1019626763_1019626771

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1019626763 1019626771
Species Human (GRCh38) Human (GRCh38)
Location 7:2019740-2019762 7:2019786-2019808
Sequence CCTCGCCACGCCACAGTGCTGAG GCTCGGCCCACGCCTGCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!