ID: 1019647712_1019647720

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1019647712 1019647720
Species Human (GRCh38) Human (GRCh38)
Location 7:2139941-2139963 7:2139963-2139985
Sequence CCCCCACAGGCCTCAGTTTCCCT TGTTTTTATGGTCTACTATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 24, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!