ID: 1019655516_1019655520

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1019655516 1019655520
Species Human (GRCh38) Human (GRCh38)
Location 7:2192611-2192633 7:2192643-2192665
Sequence CCTAGGGAACTGATTCTCCACAG TTTTAAAAAATTCTAAGGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 10, 2: 9, 3: 135, 4: 1313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!