ID: 1019659429_1019659438

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1019659429 1019659438
Species Human (GRCh38) Human (GRCh38)
Location 7:2215761-2215783 7:2215785-2215807
Sequence CCCACCCCATCACAGCAACCTCC TGTTGTAGGTGAGCAGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 449} {0: 1, 1: 0, 2: 0, 3: 19, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!