ID: 1019659430_1019659442

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1019659430 1019659442
Species Human (GRCh38) Human (GRCh38)
Location 7:2215762-2215784 7:2215815-2215837
Sequence CCACCCCATCACAGCAACCTCCA CACAATACCGAGGCTCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 509} {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!