ID: 1019662497_1019662510

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1019662497 1019662510
Species Human (GRCh38) Human (GRCh38)
Location 7:2232634-2232656 7:2232658-2232680
Sequence CCCAGCACAGCCCAAAGGGGGAG GGGGACAGGGGAGTGGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 219} {0: 1, 1: 7, 2: 310, 3: 818, 4: 3766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!