ID: 1019664778_1019664783

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1019664778 1019664783
Species Human (GRCh38) Human (GRCh38)
Location 7:2246366-2246388 7:2246388-2246410
Sequence CCAGGAAAATGCTCTGAGGGCCT TGACGTTGGCTGGGAGAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171} {0: 1, 1: 0, 2: 0, 3: 21, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!