ID: 1019664930_1019664942

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1019664930 1019664942
Species Human (GRCh38) Human (GRCh38)
Location 7:2247141-2247163 7:2247167-2247189
Sequence CCTGGGGCAACCCCAGGCCCGTG CTCAGGAGCGGGAGGCAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 110, 4: 1121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!