ID: 1019667173_1019667181

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1019667173 1019667181
Species Human (GRCh38) Human (GRCh38)
Location 7:2257706-2257728 7:2257743-2257765
Sequence CCCCCAGCCAAGGAGCAGCCAAG ACTGCAGCAGATCCAAGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 305} {0: 1, 1: 1, 2: 2, 3: 27, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!