ID: 1019689811_1019689825

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1019689811 1019689825
Species Human (GRCh38) Human (GRCh38)
Location 7:2404112-2404134 7:2404156-2404178
Sequence CCGAGGGCCCCCGTGTGCCTGCT GGCCCCGCCGACCGCAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 229} {0: 1, 1: 1, 2: 0, 3: 36, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!