ID: 1019742554_1019742562

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1019742554 1019742562
Species Human (GRCh38) Human (GRCh38)
Location 7:2682116-2682138 7:2682140-2682162
Sequence CCAGAAGCTCAAAGGGCGGCCTC CAGGCTGGGCACAGGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 88} {0: 1, 1: 0, 2: 13, 3: 140, 4: 1015}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!