ID: 1019744345_1019744354

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1019744345 1019744354
Species Human (GRCh38) Human (GRCh38)
Location 7:2691261-2691283 7:2691298-2691320
Sequence CCCCTCAAGAGTAGGGGAAGGTC GGAGTCAGGGGTCTCTGTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 30, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!