ID: 1019809310_1019809317

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1019809310 1019809317
Species Human (GRCh38) Human (GRCh38)
Location 7:3152853-3152875 7:3152898-3152920
Sequence CCAGTGATATGGGACCGATCATT GGGGCTAAGCGATTTGCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61} {0: 1, 1: 1, 2: 20, 3: 165, 4: 987}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!