ID: 1019842026_1019842032

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1019842026 1019842032
Species Human (GRCh38) Human (GRCh38)
Location 7:3456852-3456874 7:3456877-3456899
Sequence CCCTTAGTTAGGTTTAGCACTCA TTCTGGCCTGCTTTTGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 56} {0: 1, 1: 0, 2: 3, 3: 21, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!