ID: 1019892107_1019892116

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1019892107 1019892116
Species Human (GRCh38) Human (GRCh38)
Location 7:3955094-3955116 7:3955136-3955158
Sequence CCCACATGTGCCCTGCTCCTGCT CTCGGACGGCGAGTTTTCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 420} {0: 1, 1: 0, 2: 0, 3: 1, 4: 10}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!