ID: 1019931313_1019931318

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1019931313 1019931318
Species Human (GRCh38) Human (GRCh38)
Location 7:4225172-4225194 7:4225202-4225224
Sequence CCCATGTCCCAGTTGTGAGACTG GTTTTGCAGGATGTTACCACTGG
Strand - +
Off-target summary No data {0: 2, 1: 23, 2: 120, 3: 262, 4: 493}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!