ID: 1020016656_1020016664

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1020016656 1020016664
Species Human (GRCh38) Human (GRCh38)
Location 7:4835449-4835471 7:4835486-4835508
Sequence CCCGGAGGAGCACACGAGAGACC CTTTGAGACAGCGACAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130} {0: 1, 1: 0, 2: 2, 3: 4, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!