ID: 1020111634_1020111641

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1020111634 1020111641
Species Human (GRCh38) Human (GRCh38)
Location 7:5451167-5451189 7:5451203-5451225
Sequence CCCGCAGGCCTTCAAGGTTCCCA GACTCCACCCCCACTGTGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 13, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!