ID: 1020114882_1020114890

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1020114882 1020114890
Species Human (GRCh38) Human (GRCh38)
Location 7:5470714-5470736 7:5470751-5470773
Sequence CCCTTCCCGGGGGGGAGATGTCC GAACACAGCAGAGTGGCCCCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 79} {0: 1, 1: 1, 2: 7, 3: 52, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!