ID: 1020137060_1020137065

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1020137060 1020137065
Species Human (GRCh38) Human (GRCh38)
Location 7:5593521-5593543 7:5593539-5593561
Sequence CCTGCGCCACGACGGGCGCCTGG CCTGGTGGCGCGCCCCGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113} {0: 2, 1: 0, 2: 0, 3: 17, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!