ID: 1020192314_1020192330

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1020192314 1020192330
Species Human (GRCh38) Human (GRCh38)
Location 7:6009521-6009543 7:6009569-6009591
Sequence CCAGTGCGCACGCGCGGCGACCG CGGAGCGAGCGCGTCCCAACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 6, 4: 67} {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!