ID: 1020270279_1020270290

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1020270279 1020270290
Species Human (GRCh38) Human (GRCh38)
Location 7:6590532-6590554 7:6590577-6590599
Sequence CCCCAGCGATGCAGGGCTGTGTC AGGATCCCCGCGCTCGCGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 305} {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!