ID: 1020396715_1020396718

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1020396715 1020396718
Species Human (GRCh38) Human (GRCh38)
Location 7:7725490-7725512 7:7725524-7725546
Sequence CCATCTTTTGCAGATAACTACTC GACAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!