ID: 1020445225_1020445237

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1020445225 1020445237
Species Human (GRCh38) Human (GRCh38)
Location 7:8261673-8261695 7:8261695-8261717
Sequence CCCTGGACGCAAGTCCCTGCCCA ACCAGGGAGCTCGGGGTCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!