ID: 1020664855_1020664856

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1020664855 1020664856
Species Human (GRCh38) Human (GRCh38)
Location 7:11027277-11027299 7:11027297-11027319
Sequence CCATTTATGTTCTACTGTTATTA TTAGAGAAATTATATTAACTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 37, 4: 460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!