ID: 1020705329_1020705334

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1020705329 1020705334
Species Human (GRCh38) Human (GRCh38)
Location 7:11537096-11537118 7:11537133-11537155
Sequence CCCATATTCCTCCTAGTGCTAAC GAAGTATGACAAGAACTACTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 5, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!