ID: 1020935709_1020935712

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1020935709 1020935712
Species Human (GRCh38) Human (GRCh38)
Location 7:14461133-14461155 7:14461172-14461194
Sequence CCACAGGAAAGAGCAGGAAAGGT AACATCACAATTAAAAGCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 117, 2: 105, 3: 92, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!