ID: 1021093857_1021093861

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1021093857 1021093861
Species Human (GRCh38) Human (GRCh38)
Location 7:16512682-16512704 7:16512725-16512747
Sequence CCAGCTTCCAAAACGGTGGGAAA TCCACGAGGTTTATGGTATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 52, 3: 552, 4: 3013} {0: 1, 1: 0, 2: 0, 3: 3, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!