ID: 1021243490_1021243493

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1021243490 1021243493
Species Human (GRCh38) Human (GRCh38)
Location 7:18233861-18233883 7:18233887-18233909
Sequence CCACATTGGAGAGCTTTCAAGAC CTGTAGGAAACTTGGCAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132} {0: 1, 1: 0, 2: 3, 3: 16, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!