ID: 1021313033_1021313043

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1021313033 1021313043
Species Human (GRCh38) Human (GRCh38)
Location 7:19116502-19116524 7:19116536-19116558
Sequence CCGGCCTTCCGGGGACGCTGGGG CGGTGCCAAGTGAGGTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 261} {0: 1, 1: 0, 2: 2, 3: 10, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!