ID: 1021395213_1021395214

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1021395213 1021395214
Species Human (GRCh38) Human (GRCh38)
Location 7:20139130-20139152 7:20139161-20139183
Sequence CCACATTTCTTTGAGGCTGTGTG CTAAATTCTAGCAGCCTTAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 210, 4: 5195} {0: 1, 1: 0, 2: 3, 3: 9, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!