ID: 1021401399_1021401402

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1021401399 1021401402
Species Human (GRCh38) Human (GRCh38)
Location 7:20213531-20213553 7:20213557-20213579
Sequence CCCATAATGATGGACTGGATAAA AATGTGGTACATATACACCATGG
Strand - +
Off-target summary {0: 2, 1: 25, 2: 687, 3: 18256, 4: 15865} {0: 3058, 1: 26518, 2: 15879, 3: 9004, 4: 6202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!