ID: 1021446469_1021446473

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1021446469 1021446473
Species Human (GRCh38) Human (GRCh38)
Location 7:20739057-20739079 7:20739107-20739129
Sequence CCAAATCGGGGGCTGCGCATCTG ATAGACAGCCGCAGTCAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39} {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!