ID: 1021510524_1021510532

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1021510524 1021510532
Species Human (GRCh38) Human (GRCh38)
Location 7:21428088-21428110 7:21428139-21428161
Sequence CCAGCGGCGGCCATTCGCGGAAA CTCCTCCGAGCCACCGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 13} {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!