ID: 1021590466_1021590471

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1021590466 1021590471
Species Human (GRCh38) Human (GRCh38)
Location 7:22255476-22255498 7:22255498-22255520
Sequence CCAGTGACTTGGGAGGCTGAGGT TGGGAGGATCACCTGACTCTGGG
Strand - +
Off-target summary No data {0: 2, 1: 118, 2: 2021, 3: 10799, 4: 35336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!