ID: 1021744111_1021744115

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1021744111 1021744115
Species Human (GRCh38) Human (GRCh38)
Location 7:23721657-23721679 7:23721694-23721716
Sequence CCTGACAGCACAGGGAGGGAGTC TTACCATTATCATTCTTACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 236} {0: 1, 1: 1, 2: 1, 3: 32, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!