ID: 1021842545_1021842547

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1021842545 1021842547
Species Human (GRCh38) Human (GRCh38)
Location 7:24732614-24732636 7:24732628-24732650
Sequence CCGTGTGCTGTAGGAGGGAGAGC AGGGAGAGCACAGCAACTGTGGG
Strand - +
Off-target summary No data {0: 2, 1: 17, 2: 44, 3: 125, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!