ID: 1022099935_1022099952

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1022099935 1022099952
Species Human (GRCh38) Human (GRCh38)
Location 7:27163464-27163486 7:27163512-27163534
Sequence CCTGAGGTTTAGAGCCGCTTTGT GGGTGAGAGAAGGGAGAAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42} {0: 1, 1: 0, 2: 14, 3: 240, 4: 2085}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!